View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17166_high_113 (Length: 231)

Name: NF17166_high_113
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17166_high_113
NF17166_high_113
[»] chr4 (1 HSPs)
chr4 (19-216)||(13972584-13972781)


Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 216
Target Start/End: Original strand, 13972584 - 13972781
Alignment:
Q  19 cccccttggcaaaggcaactgatattcaaagaatgctctcgagaaatgtctctgtattttcctcttcagcagcactctttgataaattggagaagaagca 118  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13972584 cccccttggcaaaggcaaccgatattcaaagaatgctctcgagaaatgtctctgtattttcctcttcagcagcactctttgataaattggagaagaagca 13972683  T
Q  119 actttccatagacgaagatattcctttagatggaaagagcaatgatagctccgttcttaatagattgaagtcaagttatagtcggaccgctagtataa 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13972684 actttccatagacgaagatattcctttagatggaaagagcaatgatagctccgttcttaatagattgaagtcaagttatagtcggaccgctagtataa 13972781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University