View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17164_low_16 (Length: 243)

Name: NF17164_low_16
Description: NF17164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17164_low_16
NF17164_low_16
[»] chr3 (1 HSPs)
chr3 (9-209)||(46603419-46603628)


Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 9 - 209
Target Start/End: Complemental strand, 46603628 - 46603419
Alignment:
Q  9 aacagagaatatatcatggtccaactctataccccactttgcaactgctcctctatcacgtataaatcataattcataactatcataccccaatccaaaa 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46603628 aacagagaatatatcatggtccaactctataccccactttgcaactgctcctctatcacgtataaatcataattcataactatcataccccaatccaaaa 46603529  T
Q  109 ctacattgatcacaagttaccattcctatccg---------catcattataatatacaatgatgatcgtctttaacgtgtgtcatgctgtgttgtgtcac 199  Q
    |||||||||||||||||||||||| |||||||         ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||     
T  46603528 ctacattgatcacaagttaccattactatccgcatcttccgcatcattataatatacaatgatgattgtctttaacgtgtgtcatgctgtgttgtatcat 46603429  T
Q  200 tttctattta 209  Q
    ||| ||||||    
T  46603428 tttttattta 46603419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University