View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1715_low_80 (Length: 361)

Name: NF1715_low_80
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1715_low_80
NF1715_low_80
[»] chr2 (3 HSPs)
chr2 (69-170)||(2492770-2492871)
chr2 (72-170)||(2489489-2489587)
chr2 (72-170)||(2495900-2495998)
[»] chr6 (1 HSPs)
chr6 (187-332)||(4150046-4150191)


Alignment Details
Target: chr2 (Bit Score: 86; Significance: 5e-41; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 69 - 170
Target Start/End: Complemental strand, 2492871 - 2492770
Alignment:
Q  69 actttattggattctcttgcttcaaacgtggttgatcaccatggattttaccaaaccattgcaggagaaaactccagcagggtttatggttcaatattat 168  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||| ||||||||||||||||||    
T  2492871 actttattgaattctcttgcttcaaacgtggttgatcaccatggattttaccaaaccattgcaggagaaaacaacagcaggatttatggttcaatattat 2492772  T
Q  169 gt 170  Q
    ||    
T  2492771 gt 2492770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 72 - 170
Target Start/End: Complemental strand, 2489587 - 2489489
Alignment:
Q  72 ttattggattctcttgcttcaaacgtggttgatcaccatggattttaccaaaccattgcaggagaaaactccagcagggtttatggttcaatattatgt 170  Q
    ||||||||||||||||||||||| |||||||||||||| |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||    
T  2489587 ttattggattctcttgcttcaaatgtggttgatcaccaaggattttaccaaaccactgtaggagaaaactccagcagggtttatggttcaatattatgt 2489489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 72 - 170
Target Start/End: Complemental strand, 2495998 - 2495900
Alignment:
Q  72 ttattggattctcttgcttcaaacgtggttgatcaccatggattttaccaaaccattgcaggagaaaactccagcagggtttatggttcaatattatgt 170  Q
    |||||||||||||||||||||||||| ||||||  ||||||||||||||||||||||| |||| ||||  | | |||| |||||||| |||||||||||    
T  2495998 ttattggattctcttgcttcaaacgtcgttgatagccatggattttaccaaaccattgtaggaaaaaagcctaacaggctttatggtacaatattatgt 2495900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 74; Significance: 7e-34; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 187 - 332
Target Start/End: Original strand, 4150046 - 4150191
Alignment:
Q  187 agagtgatagaattgattttaccttatatcaaatgttatgaaacataaacacaaacatacaaaccggacacgaaaccaacatctatatgcagacaccgat 286  Q
    |||||| |||||||||||||||||| ||||||||| ||||||||||  |||||||||||||||||| |||||  ||| ||||||||| | |||||| ||     
T  4150046 agagtgttagaattgattttaccttctatcaaatgatatgaaacattgacacaaacatacaaaccgaacacggcacccacatctatacgtagacactgaa 4150145  T
Q  287 aacaattaaggaaaattgaagtgattgtatgtaaccacacttatta 332  Q
    ||||||||| ||||||||| ||||||||||| || ||||| |||||    
T  4150146 aacaattaaagaaaattgatgtgattgtatgaaatcacacctatta 4150191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University