View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1715_low_122 (Length: 315)

Name: NF1715_low_122
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1715_low_122
NF1715_low_122
[»] chr1 (1 HSPs)
chr1 (16-278)||(44531626-44531888)


Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 16 - 278
Target Start/End: Original strand, 44531626 - 44531888
Alignment:
Q  16 taatgatggagacttgttccggggagaatattgtaccggttacggcgcaaaacggaggcggcggtgaagagaaaggaagagaggttggtggtgaggaaga 115  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  44531626 taatgatggagacttgttccggtgagaatattgtaccggttacggcgcaaaacggaggcggccgtgaagagaaaggaagagaggttggtggtgaggaaga 44531725  T
Q  116 tgataagatgaatatcaatattaacggtggtggaggaaataggtggccccgccaagaaacattggctctcttgaagataagatcagatatggatggtgtt 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44531726 tgataagatgaatatcaatattaacggtggtggaggaaataggtggccccgccaagaaacattggctctcttgaagataagatcagatatggatggtgtt 44531825  T
Q  216 tttcgtgattcaagtcttaagggtccactttgggaagaggtttcaaggtatagtacatctatg 278  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44531826 tttcgtgattcaagtcttaagggtccactttgggaagaggtttcaaggtatagtacatctatg 44531888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University