View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1715_low_120 (Length: 316)

Name: NF1715_low_120
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1715_low_120
NF1715_low_120
[»] chr6 (1 HSPs)
chr6 (132-285)||(12025314-12025467)


Alignment Details
Target: chr6 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 132 - 285
Target Start/End: Complemental strand, 12025467 - 12025314
Alignment:
Q  132 tttgaaaggttttttcaaatgaaaccctaatcaagagactttcgaaagaacggtggtagcaacagtttcaaatggatgaagataacatcgttgagattca 231  Q
    ||||| ||||||| ||||| ||||||||||||||||||||||   ||||||||||||||||| |||||||||||||||||||| ||||||||||||||||    
T  12025467 tttgataggttttgtcaaacgaaaccctaatcaagagactttgagaagaacggtggtagcaagagtttcaaatggatgaagatgacatcgttgagattca 12025368  T
Q  232 tcccttcaaaaagcataaacgtgtatgcatgcatacttctattttcattgcttt 285  Q
    |||||||||||||||||||||||||||||| ||| |||||||||||||| ||||    
T  12025367 tcccttcaaaaagcataaacgtgtatgcattcatgcttctattttcattacttt 12025314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University