View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1715_high_223 (Length: 214)

Name: NF1715_high_223
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1715_high_223
NF1715_high_223
[»] chr5 (1 HSPs)
chr5 (1-201)||(13886300-13886502)


Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 13886300 - 13886502
Alignment:
Q  1 gatagagaacaaaacggtttgattacatatggtcatttgattaatgacactagaacaagtcctattgttcaaaagatggtgaataagaatggtttgtgga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  13886300 gatagagaacaaaacggtttgattacatatggtcatttgattaatgacactagaacaagtcatattgttcaaaagatggtgaataagaatggtttgtgga 13886399  T
Q  101 aaaagaagtttgttgagattatgactgcaactaaatcattatagatcagtgtaaattgtttgaaaaataaaat--tattgagataaattccaaagtaaaa 198  Q
    || ||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| || |||||||| |  ||||||||| |||||||||||||||    
T  13886400 aacagaagtttgttgagattatgactgcaactaaatcattgtagataagtgtaaattgtctgtaaaataaagttatattgagatgaattccaaagtaaaa 13886499  T
Q  199 gat 201  Q
    |||    
T  13886500 gat 13886502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University