View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17159_high_13 (Length: 323)

Name: NF17159_high_13
Description: NF17159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17159_high_13
NF17159_high_13
[»] chr8 (2 HSPs)
chr8 (1-295)||(29606455-29606749)
chr8 (238-288)||(29606327-29606377)


Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-166; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 29606749 - 29606455
Alignment:
Q  1 ggtggtatagataatggtggtagagaaacaggtgcttttttgggtggatgtggtggtggttgaattttaggggatggggtttttgggcttaatgccggtg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29606749 ggtggtatagataatggtggtagagaaacaggtgcttttttgggtggatgtggtggtggttgaattttaggggatggggtttttgggcttaatgccggtg 29606650  T
Q  101 taacctttgggactggcaactttacaggagcgagttttggaggatccggaactggtgatttgacaggagcagttgttggaggttttgattttggaactgg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29606649 taacctttgggactggcaactttacaggagcgagttttggaggatccggaactggtgatttgacaggagcagttgttggaggttttgattttggaactgg 29606550  T
Q  201 tggtttcacaggagaaggttttggtgcgggagctttcggaactggtggtttcaaaggagcagatgttggagttgtagtttttggaactattggtt 295  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29606549 tggtttcacaggagaaggttttggtgcgggagctttcggaactggtggtttcaaaggagcagatgttggagttgtagtttttggaactattggtt 29606455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 238 - 288
Target Start/End: Complemental strand, 29606377 - 29606327
Alignment:
Q  238 ggaactggtggtttcaaaggagcagatgttggagttgtagtttttggaact 288  Q
    |||||||| ||||||| |||||||||||||||||| |||| ||||||||||    
T  29606377 ggaactggcggtttcacaggagcagatgttggagtcgtagcttttggaact 29606327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University