View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17158_low_67 (Length: 201)

Name: NF17158_low_67
Description: NF17158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17158_low_67
NF17158_low_67
[»] chr3 (1 HSPs)
chr3 (50-186)||(38554439-38554575)


Alignment Details
Target: chr3 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 50 - 186
Target Start/End: Complemental strand, 38554575 - 38554439
Alignment:
Q  50 tcttaaaaatttctaataacgtacatgtataggagccatattatatgatattatgattatcaaaaaaggaatcagggtaatgtcatgccataaaaatata 149  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  38554575 tcttaaaaatttctaataacttacatgtataggagccatattatatgatattataattatcaaaaaaggaatcagggtaatgtcatgccataaaaatata 38554476  T
Q  150 tagagaatagctaatgcataaatacagaataaaaagt 186  Q
    |||||||||| ||||||||||||||||||||||||||    
T  38554475 tagagaataggtaatgcataaatacagaataaaaagt 38554439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University