View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17158_high_60 (Length: 206)

Name: NF17158_high_60
Description: NF17158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17158_high_60
NF17158_high_60
[»] chr5 (1 HSPs)
chr5 (19-185)||(36598000-36598166)


Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 19 - 185
Target Start/End: Complemental strand, 36598166 - 36598000
Alignment:
Q  19 atgttggatgtgtctatcgtatgatgtcacctgcttccaggtcctaaattggacccgagtccaaaccagatggattttgacccagttcaaaacaattgta 118  Q
    ||||||||||||||||| |||||||||| |||||| |||||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||    
T  36598166 atgttggatgtgtctattgtatgatgtcgcctgctcccaggttctaaatcggacccgagtccaaaccagatggattttgaccgagttcaaaacaattgta 36598067  T
Q  119 aatttaactattaacgttacaaaactagatatttaatgttaaaaaatatatattgtagtgcatccat 185  Q
    ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  36598066 aatttaattattaacattacaaaactagatatttaatgttaaaaaatatatattgtagtacatccat 36598000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University