View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17158_high_48 (Length: 248)

Name: NF17158_high_48
Description: NF17158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17158_high_48
NF17158_high_48
[»] chr3 (1 HSPs)
chr3 (1-234)||(7906503-7906736)


Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 7906503 - 7906736
Alignment:
Q  1 caagttttaaatactcagaagaagatatgattccatgattagtctccaaactcattaccttatcttcaacacatttaagctttctctctaattgtttgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7906503 caagttttaaatactcagaagaagatatgattccatgattagtctccaaactcattaccttatcttcaacacatttaagctttctctctaattgtttgat 7906602  T
Q  101 gcaactttcctttctttcattgattgaacacaattggaactcaagatccaagagagtttttctcaactcattagagacagttttgcttgaagataatgct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7906603 gcaactttcctttctttcattgattgaacacaattggaactcaagatccaagagagtttttctcaactcattagagacagttttgcttgaagataatgct 7906702  T
Q  201 tttataatgtgttgagctgcagcaaccatgtctt 234  Q
    ||||||||||||||||||||||||||||||||||    
T  7906703 tttataatgtgttgagctgcagcaaccatgtctt 7906736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University