View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17153_low_7 (Length: 327)

Name: NF17153_low_7
Description: NF17153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17153_low_7
NF17153_low_7
[»] chr6 (3 HSPs)
chr6 (36-173)||(34842277-34842414)
chr6 (187-259)||(34838468-34838540)
chr6 (258-313)||(34838374-34838429)


Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 36 - 173
Target Start/End: Complemental strand, 34842414 - 34842277
Alignment:
Q  36 tcaaccaaattgttacctaaacacgattttttcgtataacattgaaaataaattaaaattaggttgcaaacatcttgaaacgtgtacaatcttcataatt 135  Q
    ||||||||||||||| |||||||||||||||| ||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||    
T  34842414 tcaaccaaattgttaactaaacacgatttttttgtataacgttgaaaataaattaaaattatgttgcaaacatcttgaaacgtatacaatcttcataatt 34842315  T
Q  136 gttttcgaaatgcatgcataactcatcacataaaacaa 173  Q
    ||||||||||||||||||||||||||||||||||||||    
T  34842314 gttttcgaaatgcatgcataactcatcacataaaacaa 34842277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 187 - 259
Target Start/End: Complemental strand, 34838540 - 34838468
Alignment:
Q  187 tatagttcttggaagaaacccttgaatggttggtataagatacatgtggatggttctcattggtgttgggttg 259  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34838540 tatagttcttggaagaaacccttgaatggttggtataagatacatgtggatggttctcattggtgttgggttg 34838468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 313
Target Start/End: Complemental strand, 34838429 - 34838374
Alignment:
Q  258 tgatagaaacactaaaattccagcaacnnnnnnntatagagatattagaatttact 313  Q
    |||||||||||||||||||||||||||       ||||||||||||||||||||||    
T  34838429 tgatagaaacactaaaattccagcaacaaaaaaatatagagatattagaatttact 34838374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University