View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17152_low_93 (Length: 234)

Name: NF17152_low_93
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17152_low_93
NF17152_low_93
[»] chr1 (2 HSPs)
chr1 (66-216)||(47481069-47481219)
chr1 (187-219)||(870985-871017)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 66 - 216
Target Start/End: Complemental strand, 47481219 - 47481069
Alignment:
Q  66 gcgtttgtgatattgagtttggcctcttaggattgaattatttgaacttgtatagtgacatataagtatttgtgaataataacttttgaaaatagtttat 165  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47481219 gcgtttgtgatattgagttaggcctcttaggattgaattatttgaacttgtatagtgacatataagtatttgtgaataataacttttgaaaatagtttat 47481120  T
Q  166 agtttatactatatcgtttgatttatcttttgttataaaaatagttgatac 216  Q
    ||||||||||||||||||||||||||||||||||| | |||||||||||||    
T  47481119 agtttatactatatcgtttgatttatcttttgttagagaaatagttgatac 47481069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 219
Target Start/End: Complemental strand, 871017 - 870985
Alignment:
Q  187 tttatcttttgttataaaaatagttgatacata 219  Q
    ||||||||||||||||||||||||| |||||||    
T  871017 tttatcttttgttataaaaatagtttatacata 870985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University