View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1714_low_30 (Length: 263)

Name: NF1714_low_30
Description: NF1714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1714_low_30
NF1714_low_30
[»] chr5 (2 HSPs)
chr5 (111-263)||(29092654-29092806)
chr5 (9-77)||(29092803-29092871)


Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 111 - 263
Target Start/End: Complemental strand, 29092806 - 29092654
Alignment:
Q  111 caagtcattggttcttgatctgctctcatgatcagtgcttctcattaccatgttatttctctctaactttacaagaaaaatttgtgattctttgctggca 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29092806 caagtcattggttcttgatctgctctcatgatcagtgcttctcattaccatgttatttctctctaactttacaagaaaaatttgtgattctttgctggca 29092707  T
Q  211 ttacttcattttagtgcccatgtctttggtactaacatagagattgtggcaac 263  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||||    
T  29092706 ttacttcatatcagtgcccatgtctttggtactaacatagagattgtggcaac 29092654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 9 - 77
Target Start/End: Complemental strand, 29092871 - 29092803
Alignment:
Q  9 gattatactgcaaataacttactattttgttaatttattccaaagnnnnnnnattggagtatttacaag 77  Q
    ||||| |||||||||||||| ||||||||||||||||||||||||       |||||||||||||||||    
T  29092871 gattacactgcaaataactttctattttgttaatttattccaaagtttttttattggagtatttacaag 29092803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University