View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17146_high_31 (Length: 302)

Name: NF17146_high_31
Description: NF17146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17146_high_31
NF17146_high_31
[»] chr6 (2 HSPs)
chr6 (132-283)||(25355195-25355346)
chr6 (37-87)||(25355104-25355154)
[»] chr2 (1 HSPs)
chr2 (127-283)||(15763159-15763319)


Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 132 - 283
Target Start/End: Original strand, 25355195 - 25355346
Alignment:
Q  132 gattgttatcagtcatctttttcaatgcaccatgtttaacagaaacaatgattatgacaatacttaggcttgctacatttcaaggcttatatgttgatat 231  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  25355195 gattgttatcagtcatctctttcaatgcaccatgtttaacagaaacaatgattatgacaatacttaggcttgctacatttcaaggcttatatgatgatat 25355294  T
Q  232 ggtatcaaagattgcttgcatactattgcaaggaaaaaataatgatgatgtc 283  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  25355295 ggtatcaaagattgcttgcatactattgcaaggaaaaaataatgattatgtc 25355346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 37 - 87
Target Start/End: Original strand, 25355104 - 25355154
Alignment:
Q  37 cggtttgaatcatccccttcaataacatcctaaatgaaaagtagatcaata 87  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  25355104 cggtttgaatcatccccttcaataacatcctaaatgaaaattagatcaata 25355154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 127 - 283
Target Start/End: Complemental strand, 15763319 - 15763159
Alignment:
Q  127 cataggattgttatcagtcatctttttcaatgcaccatgtttaacagaaacaatgattatgacaatacttaggcttgctacatttcaaggcttatatgtt 226  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |    
T  15763319 cataggattgttatcagtcatctctttcaatgcaccatgtttaacagaaacaatgattatgacaatactgaggcttgctacatttcaaggcttatatgat 15763220  T
Q  227 gatatggtatcaaagattgcttgc----atactattgcaaggaaaaaataatgatgatgtc 283  Q
    ||||||||||||||||||||||||    ||||||||||||||||||||||||||| |||||    
T  15763219 gatatggtatcaaagattgcttgcatatatactattgcaaggaaaaaataatgattatgtc 15763159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University