View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17143_high_6 (Length: 225)

Name: NF17143_high_6
Description: NF17143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17143_high_6
NF17143_high_6
[»] chr2 (1 HSPs)
chr2 (4-63)||(29471453-29471512)


Alignment Details
Target: chr2 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 4 - 63
Target Start/End: Original strand, 29471453 - 29471512
Alignment:
Q  4 tcatcagacattacaacattaatctaagtatggaatgcacatagtattcaaacactacac 63  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29471453 tcatcagacattacaacattaatctaagtatggaatgcacatagtattcaaacactacac 29471512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University