View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17142_low_3 (Length: 240)

Name: NF17142_low_3
Description: NF17142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17142_low_3
NF17142_low_3
[»] chr1 (1 HSPs)
chr1 (139-171)||(1432109-1432141)


Alignment Details
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 171
Target Start/End: Original strand, 1432109 - 1432141
Alignment:
Q  139 ctgatgtgatcattgtatttatatgatcatata 171  Q
    |||||||||||||||||||||||||||||||||    
T  1432109 ctgatgtgatcattgtatttatatgatcatata 1432141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University