View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1713_low_2 (Length: 343)

Name: NF1713_low_2
Description: NF1713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1713_low_2
NF1713_low_2
[»] chr8 (3 HSPs)
chr8 (22-341)||(26972733-26973052)
chr8 (22-341)||(14759188-14759507)
chr8 (224-336)||(23133137-23133249)
[»] chr4 (3 HSPs)
chr4 (84-341)||(54477958-54478208)
chr4 (263-336)||(46785030-46785103)
chr4 (251-330)||(14307291-14307370)
[»] scaffold0036 (1 HSPs)
scaffold0036 (23-297)||(68137-68411)
[»] chr2 (9 HSPs)
chr2 (220-336)||(16321925-16322041)
chr2 (265-341)||(26790842-26790918)
chr2 (260-341)||(19264932-19265013)
chr2 (224-336)||(14654232-14654344)
chr2 (260-341)||(40327694-40327775)
chr2 (281-339)||(177030-177088)
chr2 (263-341)||(39012049-39012127)
chr2 (260-341)||(35135769-35135850)
chr2 (260-336)||(42403772-42403848)
[»] scaffold0214 (1 HSPs)
scaffold0214 (263-341)||(8486-8564)
[»] chr7 (3 HSPs)
chr7 (230-341)||(16770514-16770625)
chr7 (227-339)||(23208421-23208533)
chr7 (263-341)||(1579712-1579790)
[»] chr3 (7 HSPs)
chr3 (224-333)||(26433253-26433362)
chr3 (263-341)||(17718908-17718986)
chr3 (263-341)||(19020137-19020215)
chr3 (263-341)||(3660165-3660243)
chr3 (227-341)||(38647732-38647846)
chr3 (224-336)||(11896631-11896743)
chr3 (263-340)||(24730901-24730978)
[»] chr1 (4 HSPs)
chr1 (224-336)||(20284332-20284444)
chr1 (228-341)||(43297845-43297958)
chr1 (249-341)||(5193604-5193696)
chr1 (227-341)||(1524453-1524567)
[»] chr5 (5 HSPs)
chr5 (263-341)||(23944537-23944615)
chr5 (281-341)||(23621171-23621231)
chr5 (272-341)||(6641566-6641635)
chr5 (220-336)||(7813303-7813419)
chr5 (23-127)||(7813106-7813210)
[»] chr6 (2 HSPs)
chr6 (263-341)||(24894389-24894467)
chr6 (227-341)||(35232972-35233086)


Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 22 - 341
Target Start/End: Original strand, 26972733 - 26973052
Alignment:
Q  22 catcatcagaagaaagaaaaatcggatccataggctgcaactcccttgtggtacatggtcgaatgatagtgacaccctccaagaagaagcacaaaattat 121  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||  ||||||||||||| ||||||||||||||||||||||||    
T  26972733 catcatcagaagaaagaaaaatcggatccataggcttcaactcccttgtggtacatggtcatatgatagtgacactctccaagaagaagcacaaaattat 26972832  T
Q  122 tttaaagctttcttcagtggtatcgaacctaaccatgacagaagtttcaatgaaggcatccaccctaccatagatgacgatgggaagctctctttactct 221  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||    
T  26972833 ttcaaagctttcttcagtggtatcgaacctaaccatgacagaagtttcaatgaaggcatccaccctaccatagatgaagattggaagctctctttactct 26972932  T
Q  222 ctccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaata 321  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  26972933 ctccaatcaccaaaagagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggctttcactgcatcttttttaaacaata 26973032  T
Q  322 ctggcatattgttggagatg 341  Q
    ||||||||| ||||||||||    
T  26973033 ctggcatatagttggagatg 26973052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 22 - 341
Target Start/End: Original strand, 14759188 - 14759507
Alignment:
Q  22 catcatcagaagaaagaaaaatcggatccataggctgcaactcccttgtggtacatggtcgaatgatagtgacaccctccaagaagaagcacaaaattat 121  Q
    |||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||  ||||||||||||| ||||||||||||||||||||||||    
T  14759188 catcattagaagaaagaaaaatcgggtccataggctgcaactcccttgtggtacatggtcatatgatagtgacactctccaagaagaagcacaaaattat 14759287  T
Q  122 tttaaagctttcttcagtggtatcgaacctaaccatgacagaagtttcaatgaaggcatccaccctaccatagatgacgatgggaagctctctttactct 221  Q
    || |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14759288 ttcaaagctttcttcagtggtatcgaacctaaccatgacagaaatttcaatgaaggcatccaccctaccatagatgacgatgggaagctctctttactct 14759387  T
Q  222 ctccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaata 321  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||     
T  14759388 ctccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggctttcactacatcttttttaaacaatc 14759487  T
Q  322 ctggcatattgttggagatg 341  Q
    ||||||||| ||||||||||    
T  14759488 ctggcatatagttggagatg 14759507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 336
Target Start/End: Complemental strand, 23133249 - 23133137
Alignment:
Q  224 ccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatact 323  Q
    |||||||||||||| || || | | |||| ||||| || ||||| ||||||||||||||||| || |||||||| || |||||||| || || || ||||    
T  23133249 ccaatcaccaaaaatgaagtttatgctgcccttaactccatgaaaccctacaaagcccctggtccggatggtttccattgcatcttcttcaagcagtact 23133150  T
Q  324 ggcatattgttgg 336  Q
    |||| ||||||||    
T  23133149 ggcacattgttgg 23133137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 68; Significance: 3e-30; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 84 - 341
Target Start/End: Complemental strand, 54478208 - 54477958
Alignment:
Q  84 atgatagtgacaccctccaagaagaagcacaaaattattttaaagctttcttcagtggtatcgaacctaaccatgacagaagtttcaatgaaggcatcca 183  Q
    ||||||||||||| |||||||||||||| ||||||||||| ||  |||||||| |||| | | |||| ||||||||| |||| |||||||  || || ||    
T  54478208 atgatagtgacactctccaagaagaagctcaaaattatttcaagactttcttcggtggcaaccaaccaaaccatgaccgaagcttcaatgttggtattca 54478109  T
Q  184 ccctaccatagatgacgatgggaagctctctttactctctccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccct 283  Q
    ||||  ||       ||| || ||||| ||||||  ||| |||||||||||||||||||| ||| || | ||||| |||||||||||||| |||||| |     
T  54478108 cccttaca-------cgagggtaagctttctttaacctccccaatcaccaaaaaagaggtgtttgcttcccttaactctatgaagccctataaagcctca 54478016  T
Q  284 ggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 341  Q
    ||||| ||||| || |||| |||||| || |||||||| ||||| |||||||| ||||    
T  54478015 ggcccagatggcttccactacatcttcttcaaacaatattggcacattgttggtgatg 54477958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 263 - 336
Target Start/End: Complemental strand, 46785103 - 46785030
Alignment:
Q  263 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttgg 336  Q
    ||||| ||||||||| | ||||| || |||||||| || |||||||| || |||||||||||||| ||||||||    
T  46785103 atgaaaccctacaaatctcctggtccggatggtttccaatgcatcttcttcaaacaatactggcacattgttgg 46785030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 251 - 330
Target Start/End: Original strand, 14307291 - 14307370
Alignment:
Q  251 gctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatat 330  Q
    ||||| || |||||||| || |||||| || ||||||| ||||||||||| ||||| || || |||||||| ||||||||    
T  14307291 gctctgaactctatgaaaccttacaaatcctctggcccagatggttttcaatgcattttcttcaaacaatattggcatat 14307370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 59; Significance: 6e-25; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 23 - 297
Target Start/End: Original strand, 68137 - 68411
Alignment:
Q  23 atcatcagaagaaagaaaaatcggatccataggctgcaactcccttgtggtacatggtcgaatgatagtgacaccctccaagaagaagcacaaaattatt 122  Q
    |||||||||||||| | |||| | |||||||| || ||||||||||||||||| |||||   |||||| ||||  || ||||| || || ||||| ||||    
T  68137 atcatcagaagaaaaagaaatagaatccatagacttcaactcccttgtggtacttggtcctctgatagcgacattcttcaagaggaggcccaaaactatt 68236  T
Q  123 ttaaagctttcttcagtggtatcgaacctaaccatgacagaagtttcaatgaaggcatccaccctaccatagatgacgatgggaagctctctttactctc 222  Q
    | ||   |||||||||||| | | |||||||||||||  ||  |||||||||||||   |||||| |||| |||| |||||||||  | ||||||   ||    
T  68237 tcaagaatttcttcagtggcaaccaacctaaccatgatcgatctttcaatgaaggcgctcacccttccattgatgccgatgggaaaatttctttaacttc 68336  T
Q  223 tccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttt 297  Q
    |||||||||||||   || || ||  |||| |||||  |||| |||||| ||||||||||||||||| |||||||    
T  68337 tccaatcaccaaacctgaagtgttcgctgcccttaaccctataaagcccaacaaagcccctggccccaatggttt 68411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 9)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 220 - 336
Target Start/End: Original strand, 16321925 - 16322041
Alignment:
Q  220 ctctccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaa 319  Q
    |||||| || |||||||||||||| ||| |||| || || || ||||| ||||||||||| ||||| |||||||| ||||| ||||| || |||||||||    
T  16321925 ctctcctattaccaaaaaagaggtttttgctgccctcaactccatgaaaccctacaaagcacctggtcccgatggctttcattgcattttctttaaacaa 16322024  T
Q  320 tactggcatattgttgg 336  Q
    |||||||| ||||||||    
T  16322025 tactggcacattgttgg 16322041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 265 - 341
Target Start/End: Original strand, 26790842 - 26790918
Alignment:
Q  265 gaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 341  Q
    |||||||||||||||||||||||||||||||||||| || || |||||||||||||| | ||| |||||||| ||||    
T  26790842 gaagccctacaaagcccctggccccgatggttttcattgtattttttttaaacaatattcgcacattgttggtgatg 26790918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 260 - 341
Target Start/End: Original strand, 19264932 - 19265013
Alignment:
Q  260 tctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 341  Q
    ||||||||||| |||||||||||||| || ||||| ||||| ||||| || || |||||||||||||| ||||| |||||||    
T  19264932 tctatgaagccatacaaagcccctggtcctgatgggtttcattgcattttcttcaaacaatactggcacattgtcggagatg 19265013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 336
Target Start/End: Complemental strand, 14654344 - 14654232
Alignment:
Q  224 ccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatact 323  Q
    |||||||||||||| || || | | |||| ||||| || ||||||||||||||||||||||| || |||||||| || |||||||| || || || ||||    
T  14654344 ccaatcaccaaaaatgaagtttatgctgcccttaactccatgaagccctacaaagcccctggtccagatggtttccattgcatcttcttcaagcagtact 14654245  T
Q  324 ggcatattgttgg 336  Q
     ||||||| ||||    
T  14654244 agcatattattgg 14654232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 260 - 341
Target Start/End: Original strand, 40327694 - 40327775
Alignment:
Q  260 tctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 341  Q
    ||||||||||| |||||||||||||| || || || ||||| ||||| || || |||||||||||||| ||||| |||||||    
T  40327694 tctatgaagccttacaaagcccctggtcctgacgggtttcattgcattttcttcaaacaatactggcacattgtcggagatg 40327775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 339
Target Start/End: Original strand, 177030 - 177088
Alignment:
Q  281 cctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggaga 339  Q
    |||||||| ||||||||||| ||||||||||| |||||||| ||||| |||||| ||||    
T  177030 cctggcccagatggttttcaatgcatctttttcaaacaatattggcacattgttagaga 177088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 263 - 341
Target Start/End: Original strand, 39012049 - 39012127
Alignment:
Q  263 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 341  Q
    ||||| ||||||||||||||||| || ||||| || || ||||| |||||||| ||||| ||||| ||| |||||||||    
T  39012049 atgaaaccctacaaagcccctggaccagatggcttccaatgcatattttttaagcaatattggcacattattggagatg 39012127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 260 - 341
Target Start/End: Complemental strand, 35135850 - 35135769
Alignment:
Q  260 tctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 341  Q
    ||||||||||| |||||||||||||| || || || ||||| ||||| || || || ||||||||||| ||||| |||||||    
T  35135850 tctatgaagccatacaaagcccctggtcctgacgggtttcattgcattttcttcaagcaatactggcacattgtcggagatg 35135769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 260 - 336
Target Start/End: Complemental strand, 42403848 - 42403772
Alignment:
Q  260 tctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttgg 336  Q
    ||||||||||| ||||| || ||||| || |||||||| || |||||||| || |||||||| ||||| ||||||||    
T  42403848 tctatgaagccttacaaggcacctggtcctgatggtttccattgcatcttcttcaaacaatattggcacattgttgg 42403772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0214 (Bit Score: 47; Significance: 9e-18; HSPs: 1)
Name: scaffold0214
Description:

Target: scaffold0214; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 263 - 341
Target Start/End: Original strand, 8486 - 8564
Alignment:
Q  263 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 341  Q
    |||||||||||||||||||||||||| ||||||||||| || || || ||||||||||  ||||| |||||||||||||    
T  8486 atgaagccctacaaagcccctggccctgatggttttcattgtattttctttaaacaattttggcacattgttggagatg 8564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 44; Significance: 5e-16; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 230 - 341
Target Start/End: Complemental strand, 16770625 - 16770514
Alignment:
Q  230 accaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcata 329  Q
    ||||||||||| ||| || |||| ||||| |||||||| || |||||||| || || || |||||||| || ||||| ||||| |||||||||||||| |    
T  16770625 accaaaaaagaagtccttgctgcccttaactctatgaaaccttacaaagcaccaggtccggatggtttccaatgcatttttttcaaacaatactggcaca 16770526  T
Q  330 ttgttggagatg 341  Q
    || |||||||||    
T  16770525 ttattggagatg 16770514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 339
Target Start/End: Complemental strand, 23208533 - 23208421
Alignment:
Q  227 atcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggc 326  Q
    ||||||||||| || || |||  ||| || ||||| ||||| || ||||||||||||||||| || || || || || ||||| || |||||||| ||||    
T  23208533 atcaccaaaaatgaagtttttgttgccctcaattccatgaaaccatacaaagcccctggcccggacggcttccattgtatcttcttcaaacaatattggc 23208434  T
Q  327 atattgttggaga 339  Q
    |||| ||||||||    
T  23208433 atatagttggaga 23208421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 341
Target Start/End: Complemental strand, 1579790 - 1579712
Alignment:
Q  263 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 341  Q
    ||||| |||||||||||||||||  | ||||  ||||| || ||||| |||||| |||| ||||| |||||||||||||    
T  1579790 atgaaaccctacaaagcccctggttcggatgagtttcaatgtatcttctttaaaaaatattggcacattgttggagatg 1579712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 224 - 333
Target Start/End: Complemental strand, 26433362 - 26433253
Alignment:
Q  224 ccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatact 323  Q
    |||||||| ||||| || || | | |||| ||||| || |||||||| |||||||||||||| || |||||||| || |||||||| || ||||| ||||    
T  26433362 ccaatcactaaaaatgaagtttatgctgcccttaactccatgaagccttacaaagcccctggtcctgatggtttccattgcatcttcttcaaacagtact 26433263  T
Q  324 ggcatattgt 333  Q
    ||||||||||    
T  26433262 ggcatattgt 26433253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 263 - 341
Target Start/End: Complemental strand, 17718986 - 17718908
Alignment:
Q  263 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 341  Q
    |||||||| ||||||||||| || || ||||||||||| || |||||||| ||||| |||||||| || ||||||||||    
T  17718986 atgaagccgtacaaagcccccggtccagatggttttcaatgtatctttttcaaacagtactggcacatagttggagatg 17718908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 263 - 341
Target Start/End: Complemental strand, 19020215 - 19020137
Alignment:
Q  263 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 341  Q
    |||||||| ||||||||||| || || ||||||||||| || |||||||| ||||| |||||||| || ||||||||||    
T  19020215 atgaagccgtacaaagcccccggtccagatggttttcaatgtatctttttcaaacagtactggcacatagttggagatg 19020137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 263 - 341
Target Start/End: Complemental strand, 3660243 - 3660165
Alignment:
Q  263 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 341  Q
    ||||| ||||||||||||||||| || ||||| || || ||||| |||||||| ||||| ||||| ||| |||||||||    
T  3660243 atgaaaccctacaaagcccctggaccagatggcttccaatgcatattttttaagcaatattggcacattattggagatg 3660165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 341
Target Start/End: Complemental strand, 38647846 - 38647732
Alignment:
Q  227 atcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggc 326  Q
    ||||||||||| ||||| ||| |||| ||||| || ||||| || |||||||| || ||||| |||||||| || || ||||| || |||||||| ||||    
T  38647846 atcaccaaaaatgaggtgtttgctgcacttaactccatgaaaccttacaaagcacccggcccagatggtttccattgtatcttcttcaaacaatattggc 38647747  T
Q  327 atattgttggagatg 341  Q
    | || || |||||||    
T  38647746 acatagtcggagatg 38647732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 336
Target Start/End: Original strand, 11896631 - 11896743
Alignment:
Q  224 ccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatact 323  Q
    |||||||||||||| || || | |  ||| ||||| || ||||| ||||||||||||||||| || |||||||| || |||||||| || || || ||||    
T  11896631 ccaatcaccaaaaatgaagtttatgttgcccttaactccatgaaaccctacaaagcccctggtccggatggtttccattgcatcttcttcaagcagtact 11896730  T
Q  324 ggcatattgttgg 336  Q
    | || ||||||||    
T  11896731 gacacattgttgg 11896743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 340
Target Start/End: Original strand, 24730901 - 24730978
Alignment:
Q  263 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagat 340  Q
    ||||| || ||||||||||| || ||  |||| || || ||||| |||||||||||||| ||||| ||||||||||||    
T  24730901 atgaaaccttacaaagccccgggtccatatggcttccaatgcatattttttaaacaatattggcacattgttggagat 24730978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 336
Target Start/End: Original strand, 20284332 - 20284444
Alignment:
Q  224 ccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatact 323  Q
    |||||||||||||| || || | | |||| ||||| || ||||| ||||||||||||||||| || |||||||| || |||||||| || || || ||||    
T  20284332 ccaatcaccaaaaatgaagtttatgctgcccttaactccatgaaaccctacaaagcccctggtccggatggtttccattgcatcttcttcaagcagtact 20284431  T
Q  324 ggcatattgttgg 336  Q
    |||| ||||||||    
T  20284432 ggcacattgttgg 20284444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 228 - 341
Target Start/End: Original strand, 43297845 - 43297958
Alignment:
Q  228 tcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggca 327  Q
    |||||||||| || || ||||| || ||||| || ||||| ||||||||||| || | ||| ||||| || || |||||||| || |||||||| |||||    
T  43297845 tcaccaaaaatgatgtgtttaccgcccttaactccatgaaaccctacaaagcacccgaccctgatggcttccattgcatcttcttcaaacaatattggca 43297944  T
Q  328 tattgttggagatg 341  Q
     || ||||||||||    
T  43297945 catagttggagatg 43297958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 341
Target Start/End: Complemental strand, 5193696 - 5193604
Alignment:
Q  249 ctgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 341  Q
    |||| |||||||| ||||| || |||||||| || | ||||||||  || || |||||||| ||||||||||| ||||| || ||||||||||    
T  5193696 ctgcccttaattccatgaaaccatacaaagcacccgaccccgatgacttccattgcatcttctttaaacaatattggcacatagttggagatg 5193604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 341
Target Start/End: Original strand, 1524453 - 1524567
Alignment:
Q  227 atcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggc 326  Q
    ||||||||||  || ||||| | ||| ||||| || || || || |||||||| || | ||| ||||||||||| |||||||| || ||  |||||||||    
T  1524453 atcaccaaaaccgaagtcttcaatgcccttaactccataaaaccttacaaagcacccgaccctgatggttttcaatgcatcttcttcaagaaatactggc 1524552  T
Q  327 atattgttggagatg 341  Q
    |||| ||||||||||    
T  1524553 atatagttggagatg 1524567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 263 - 341
Target Start/End: Original strand, 23944537 - 23944615
Alignment:
Q  263 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 341  Q
    ||||| |||| ||||||||||||||| ||||||||||| || ||||| || || |||||||| || |||||||||||||    
T  23944537 atgaaacccttcaaagcccctggcccagatggttttcaatgtatcttcttcaagcaatactgacacattgttggagatg 23944615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 281 - 341
Target Start/End: Complemental strand, 23621231 - 23621171
Alignment:
Q  281 cctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 341  Q
    |||||||| ||||| || || |||||||||||||||||||| |||||||||||||| ||||    
T  23621231 cctggcccagatggcttccattgcatcttttttaaacaatattggcatattgttggtgatg 23621171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 272 - 341
Target Start/End: Complemental strand, 6641635 - 6641566
Alignment:
Q  272 tacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 341  Q
    ||||||||||||||||| ||||||||||||||||  || || | |||||||||||| | |||||| ||||    
T  6641635 tacaaagcccctggccctgatggttttcactgcaatttcttcatacaatactggcacaatgttggtgatg 6641566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 220 - 336
Target Start/End: Original strand, 7813303 - 7813419
Alignment:
Q  220 ctctccaatcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaa 319  Q
    |||||| ||||||||||| || || ||| || | || || |||||||| || ||||||||||| || || || ||||| || || ||||| || |||||     
T  7813303 ctctcccatcaccaaaaatgaagtttttgctaccctcaagtctatgaaaccttacaaagccccaggacctgacggtttccattgtatcttcttcaaacag 7813402  T
Q  320 tactggcatattgttgg 336  Q
    |||||||||||||||||    
T  7813403 tactggcatattgttgg 7813419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 127
Target Start/End: Original strand, 7813106 - 7813210
Alignment:
Q  23 atcatcagaagaaagaaaaatcggatccataggctgcaactcccttgtggtacatggtcgaatgatagtgacaccctccaagaagaagcacaaaattatt 122  Q
    ||||| ||||| |||| |||| | |||||  |||| || |||||||||||||| ||| |    ||||| ||||| ||||||||||| || ||||||||||    
T  7813106 atcattagaaggaagagaaatagaatccaccggcttcagctcccttgtggtacttggacctcagatagcgacacactccaagaagaggcccaaaattatt 7813205  T
Q  123 ttaaa 127  Q
    |||||    
T  7813206 ttaaa 7813210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 263 - 341
Target Start/End: Complemental strand, 24894467 - 24894389
Alignment:
Q  263 atgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggcatattgttggagatg 341  Q
    ||||| || ||||||||||||||| | ||||| || || || |||||||| |||||||| |||||||| ||||||||||    
T  24894467 atgaaaccatacaaagcccctggctcggatggattccattgtatctttttcaaacaatattggcatatagttggagatg 24894389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 341
Target Start/End: Original strand, 35232972 - 35233086
Alignment:
Q  227 atcaccaaaaaagaggtctttactgctcttaattctatgaagccctacaaagcccctggccccgatggttttcactgcatcttttttaaacaatactggc 326  Q
    ||||| ||||| || |||||| |||| || || || ||||| ||||||||||| || || || |||||||| || ||||| || || || ||||| ||||    
T  35232972 atcactaaaaatgaagtctttgctgccctaaactccatgaaaccctacaaagctccaggaccagatggtttccattgcatattcttcaagcaatattggc 35233071  T
Q  327 atattgttggagatg 341  Q
    ||||| |||||||||    
T  35233072 atattattggagatg 35233086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University