View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1713_low_14 (Length: 203)

Name: NF1713_low_14
Description: NF1713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1713_low_14
NF1713_low_14
[»] chr3 (1 HSPs)
chr3 (1-122)||(47170177-47170298)
[»] chr1 (1 HSPs)
chr1 (7-93)||(42165647-42165733)


Alignment Details
Target: chr3 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 47170177 - 47170298
Alignment:
Q  1 catgtctggttgggctattgctgttcatggcggcgcaggtgtggatcctaacctgccaccacaccgtcagcaagaagccaaacagcttcttaccgaatgt 100  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  47170177 catgtctggttgggctattgctgttcatggcggtgcaggtgtggatcctaacctcccaccacaccgtcagcaagaagccaaacagcttcttaccgaatgt 47170276  T
Q  101 ctcaatctcggtatctctgctc 122  Q
    ||||||||||||||||||||||    
T  47170277 ctcaatctcggtatctctgctc 47170298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 7 - 93
Target Start/End: Complemental strand, 42165733 - 42165647
Alignment:
Q  7 tggttgggctattgctgttcatggcggcgcaggtgtggatcctaacctgccaccacaccgtcagcaagaagccaaacagcttcttac 93  Q
    |||||||||||||||||| ||||| ||||| |||||||||||||| || |||||||| |||||| ||||||||||||| ||||||||    
T  42165733 tggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaacttcttac 42165647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University