View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1713_low_12 (Length: 208)

Name: NF1713_low_12
Description: NF1713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1713_low_12
NF1713_low_12
[»] chr4 (1 HSPs)
chr4 (15-126)||(2733789-2733900)


Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 15 - 126
Target Start/End: Complemental strand, 2733900 - 2733789
Alignment:
Q  15 atcaatcatgttacgaagattactcatctcttcacaactcaaaaccctaacttctcgccgatctccttcctccgccgtcgctgtttccttactctcccgc 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  2733900 atcaatcatgttacgaagattactcatctcttcacaactcaaaaccctaacttctcgccgatctccttcctccgccgttgctgtttccttactctcccgc 2733801  T
Q  115 caccacttctct 126  Q
    ||||||||||||    
T  2733800 caccacttctct 2733789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University