View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17138_high_4 (Length: 242)

Name: NF17138_high_4
Description: NF17138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17138_high_4
NF17138_high_4
[»] chr2 (1 HSPs)
chr2 (131-233)||(25300393-25300495)


Alignment Details
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 131 - 233
Target Start/End: Complemental strand, 25300495 - 25300393
Alignment:
Q  131 tttgttggaggttattttggcttgtaatcgatttgtttattttttattagaatacccctttattgtaacgatgtattttggatcttttaatgtattagta 230  Q
    ||||||||||||| |||||||||||||| ||||||||||||||||||||||  |||||||||||||||||||||||||||||||||| ||||||| ||||    
T  25300495 tttgttggaggtttttttggcttgtaatagatttgtttattttttattagacaacccctttattgtaacgatgtattttggatctttaaatgtatgagta 25300396  T
Q  231 tat 233  Q
    |||    
T  25300395 tat 25300393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University