View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17134_low_97 (Length: 255)

Name: NF17134_low_97
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17134_low_97
NF17134_low_97
[»] chr4 (1 HSPs)
chr4 (55-238)||(23352028-23352211)
[»] chr2 (1 HSPs)
chr2 (182-223)||(41188105-41188146)


Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 55 - 238
Target Start/End: Original strand, 23352028 - 23352211
Alignment:
Q  55 ttggaataattgaacaagtttagcatgattggaaatgacgattgtaggtgctatagttagatattgatatggtttcttagcagatacatatattcaaaga 154  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23352028 ttggaataattgaacaagtttagcatgattggaaatgacgattgtaggtgctatagttagatattgatatggtttcttagcagatacatatattcaaaga 23352127  T
Q  155 gcagccaaagatagggttagtagtgatgtggatgccaccattttgtgggtagaccacttaattttatctcgttgtgtgtctctc 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||    
T  23352128 gcagccaaagatagggttagtagtgatgtggatgccaccattttgtgggtaggccacttaattttatctcgtcgtgtgtctctc 23352211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 182 - 223
Target Start/End: Complemental strand, 41188146 - 41188105
Alignment:
Q  182 gtggatgccaccattttgtgggtagaccacttaattttatct 223  Q
    |||||| ||||||||||||||||| | |||||||||||||||    
T  41188146 gtggataccaccattttgtgggtacagcacttaattttatct 41188105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University