View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17134_low_46 (Length: 393)

Name: NF17134_low_46
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17134_low_46
NF17134_low_46
[»] chr6 (2 HSPs)
chr6 (1-93)||(10551299-10551391)
chr6 (199-258)||(10551093-10551152)


Alignment Details
Target: chr6 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 10551391 - 10551299
Alignment:
Q  1 atggagtcagaagatcaagctacaaataaaagaatgaaagaaacatggcaactttgttgctgattgtcatcttcaaaaggacaagtccaagaa 93  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10551391 atggagtcagaagatcaagctacaaataaaagaatgaaagaaacatggcaactttgttgctgattgtcatcttcaaaaggacaagtccaagaa 10551299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 199 - 258
Target Start/End: Complemental strand, 10551152 - 10551093
Alignment:
Q  199 ctcaactgattcttttctcttctcaatccttatcactttagacattctgttcacccctaa 258  Q
    |||| ||| |||||||||||||||||||||||||||||||||| |||| |||||||||||    
T  10551152 ctcagctggttcttttctcttctcaatccttatcactttagaccttctattcacccctaa 10551093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University