View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17134_high_140 (Length: 210)

Name: NF17134_high_140
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17134_high_140
NF17134_high_140
[»] chr3 (1 HSPs)
chr3 (78-192)||(49698217-49698331)


Alignment Details
Target: chr3 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 78 - 192
Target Start/End: Complemental strand, 49698331 - 49698217
Alignment:
Q  78 catgtaaccagaatatatgggggaaaaatatgcatgtgtctctataactgcctcagacccgtctcactttctttctattacgtctatgtttggttggcca 177  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49698331 catgtaaccagaatatatgggggaaaaatatgcatgtgtctctacaactgcctcagacccgtctcactttctttctattacgtctatgtttggttggcca 49698232  T
Q  178 cgagcaattttactc 192  Q
    |||||||||||||||    
T  49698231 cgagcaattttactc 49698217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University