View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17134_high_104 (Length: 242)

Name: NF17134_high_104
Description: NF17134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17134_high_104
NF17134_high_104
[»] chr1 (1 HSPs)
chr1 (1-229)||(9888357-9888585)


Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 9888357 - 9888585
Alignment:
Q  1 tcgtagctattttactactatctctatctttaggtataacccttttcgtttttctctcttacaatgcaacccaattgaacaattacgcgaaaactgatct 100  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9888357 tcgtagctattttactactatctttatctttaggtataacccttttcgtttttctctcttacaatgcaacccaattgaacaattacgcgaaaactgatct 9888456  T
Q  101 gggttttgatgattatccgttttcgaagctcaggaatttggttatggttgctggtcattcggtttatatgagtagtggttgtgggaagattgagaaagag 200  Q
    ||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  9888457 gggttttgatgattacccgttttcgaagctgaggaatttggttatggttgctggtcattcggtttatatgagtagtggttgtgggaagattgagaaagaa 9888556  T
Q  201 gattcgtggtatttggagagttatcagaa 229  Q
    |||||||||||||||||||||||||||||    
T  9888557 gattcgtggtatttggagagttatcagaa 9888585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University