View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17133_low_37 (Length: 235)

Name: NF17133_low_37
Description: NF17133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17133_low_37
NF17133_low_37
[»] chr7 (2 HSPs)
chr7 (20-164)||(6174086-6174230)
chr7 (167-211)||(6173895-6173939)


Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 20 - 164
Target Start/End: Complemental strand, 6174230 - 6174086
Alignment:
Q  20 gggagaggatgcaaatttgttcaactcggaagttactagaaaggtggggaatgggaatagttctagtttttgggaggtggcttggagaggagaaatcccg 119  Q
    ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||     
T  6174230 gggagaggatgcaaattggttcaactcggaagctactagaaaggtggggaatgggaatagttctaatttttgggaggtggcttggagaggggaaatccca 6174131  T
Q  120 tttcgagttaagtatcctagactttttgcgttgtctaatcaaaaa 164  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  6174130 tttcgagttaagtatcctagactttttgcgttgtctaatcaaaaa 6174086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 6173939 - 6173895
Alignment:
Q  167 tattatggttgaaaacagatgaaatattatcattctttgatatac 211  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||    
T  6173939 tattatggtttaaaacagatgaaatattatcattctttgacatac 6173895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University