View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17130_high_44 (Length: 304)

Name: NF17130_high_44
Description: NF17130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17130_high_44
NF17130_high_44
[»] chr8 (2 HSPs)
chr8 (188-304)||(34079653-34079769)
chr8 (8-78)||(34079488-34079558)


Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 188 - 304
Target Start/End: Original strand, 34079653 - 34079769
Alignment:
Q  188 atatgataattttgattagtgaatgagtgctgatgctgaagaagctgctggaattgttgtgtttgggcctgagattgagatggatgctgactttcttgat 287  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34079653 atatgataattttgattagtgaatgagtgctgatgctgaagaagctgctggaattgttgtgtttgggcctgagattgagatggatgctgactttcttgat 34079752  T
Q  288 tctttggaaaagcctga 304  Q
    |||||||||||||||||    
T  34079753 tctttggaaaagcctga 34079769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 8 - 78
Target Start/End: Original strand, 34079488 - 34079558
Alignment:
Q  8 tgagatgaaggtgcggaaacaaactgagacattgtggagacggcatttgacatctgttgatgatctacaac 78  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34079488 tgagatggaggtgcggaaacaaactgagacattgtggagacggcatttgacatctgttgatgatctacaac 34079558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University