View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1712_high_33 (Length: 253)

Name: NF1712_high_33
Description: NF1712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1712_high_33
NF1712_high_33
[»] chr7 (1 HSPs)
chr7 (17-212)||(34383979-34384174)


Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 212
Target Start/End: Complemental strand, 34384174 - 34383979
Alignment:
Q  17 atctcaccgataggggtttgagaaaatccaagaattttgaagacgaataatcaaacgagaacaccagaccatacccacatgaaagatagaacaaaatctg 116  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  34384174 atctcaccgataggggtatgagaaaatccaagaattttgaagacgaataatcgaacgagaacaccagaccatacccacatgaaagatagaacaaaatctg 34384075  T
Q  117 acactaaaaccaaactactttgtctttccatcttcaacgacgataacaagaacaacaagttctatgaatttgaggatgtttttgtgtttggaatct 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34384074 acactaaaaccaaactactttgtctttccatcttcaacgacgataacaagaacaacaagttctatgaatttgaggatgtttttgtgtttggaatct 34383979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University