View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17122_low_12 (Length: 235)

Name: NF17122_low_12
Description: NF17122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17122_low_12
NF17122_low_12
[»] chr2 (1 HSPs)
chr2 (41-191)||(3590324-3590474)


Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 41 - 191
Target Start/End: Complemental strand, 3590474 - 3590324
Alignment:
Q  41 taatatgtattttttaaaaataatcaaatatgtccctattagggaataaattttcccttagtcaatgtattacttccgacataatactcatttaattttc 140  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3590474 taatatgtattttttaaaaataatcaaatatgtccctattagagaataaattttcccttagtcaatgtattacttccgacataatactcatttaattttc 3590375  T
Q  141 caatccatatgtaccactagtcaaagacatactcgcaactattataaagaa 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3590374 caatccatatgtaccactagtcaaagacatactcgcaactattataaagaa 3590324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University