View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17122_low_11 (Length: 246)

Name: NF17122_low_11
Description: NF17122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17122_low_11
NF17122_low_11
[»] chr7 (2 HSPs)
chr7 (1-87)||(22045851-22045937)
chr7 (161-227)||(22046002-22046068)


Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 22045851 - 22045937
Alignment:
Q  1 acacgtgtccttagatatttcacactccctctcctcattttacctataaatgcgggttcaacccatgcttctatcattcagaagtaa 87  Q
    ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  22045851 acacgtgtccttagatatttcacactctctctcctcatttttcctataaatgcgggttcaacccatgcttctatcattcagaagtaa 22045937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 161 - 227
Target Start/End: Original strand, 22046002 - 22046068
Alignment:
Q  161 tgaaaatgtcttgctgtggtggaaactgtggttgtggaagtgcctgcaaatgcggcaatggctgtgg 227  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  22046002 tgaaaatgtcttgctgtggtggaaactgtggctgtggaagtgcctgcaaatgcggcaatggctgtgg 22046068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University