View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17118_low_2 (Length: 305)

Name: NF17118_low_2
Description: NF17118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17118_low_2
NF17118_low_2
[»] chr3 (2 HSPs)
chr3 (169-290)||(31396989-31397110)
chr3 (10-86)||(31397115-31397191)


Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 169 - 290
Target Start/End: Complemental strand, 31397110 - 31396989
Alignment:
Q  169 tttgctcgtggttttttagtttggttcagtgataccaacttaattaagatgattgttgctcttcgagcctacttgcttttnnnnnnnnnnnnntcactaa 268  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||             |||||||    
T  31397110 tttgctcgtggttttttagtttggttcagtgataccaacttaattaagatgattgttgctcttcgagcctacttgcttttaaaaaataaaaaatcactaa 31397011  T
Q  269 aagtaccgcaagttatattttg 290  Q
    ||||||||||||||||||||||    
T  31397010 aagtaccgcaagttatattttg 31396989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 86
Target Start/End: Complemental strand, 31397191 - 31397115
Alignment:
Q  10 catcatcatatcatataccacaacatatattacattaccaacttattaattcaaaaatatgagcgagagaccaaaat 86  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||    
T  31397191 catcatcatattatataccacaacatatattacattaccaacttattaattcaaaaatatgagcgagaaacctaaat 31397115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University