View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17118_high_1 (Length: 383)

Name: NF17118_high_1
Description: NF17118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17118_high_1
NF17118_high_1
[»] chr2 (1 HSPs)
chr2 (3-196)||(12616451-12616644)


Alignment Details
Target: chr2 (Bit Score: 178; Significance: 6e-96; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 3 - 196
Target Start/End: Original strand, 12616451 - 12616644
Alignment:
Q  3 gtttagaaagaagacagaatatgggtttgagataggttattgtgttggtaaattatagtttatactatataatattataacaagaaaaatagagaggaag 102  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  12616451 gtttagaaagaagacaaaatatgggtttgagataggttattgtgttggtaaattatagtttatgctatataatattataacaagaaaaatagagaggaag 12616550  T
Q  103 ggacgaagagggagacgaaaagagagaatatgtgaaagatgatgaggagaagtaatgtaggaaaataaccaaaataatgggatatttatgcagg 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||    
T  12616551 ggacgaagagggagacgaaaagagagaatatgtgaaagatgatgaggggaagtaatgtaggaaaataacgaaaataatgggatatttatgcagg 12616644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University