View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17117_low_92 (Length: 233)

Name: NF17117_low_92
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17117_low_92
NF17117_low_92
[»] chr7 (1 HSPs)
chr7 (17-219)||(37862431-37862634)


Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 219
Target Start/End: Complemental strand, 37862634 - 37862431
Alignment:
Q  17 aaaatactagcatgtatagaaactaagatcatcgatgatccatggctagaagtctctcg-tggtaatgatcgtaaaacacaaataaaaacgggtaatgaa 115  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  37862634 aaaatactagcatgtatagaaactaagatcatcaatgatccatggctagaagtctctcgatggtaatgatcgtaaaacacaaataaaaacgggtaatgaa 37862535  T
Q  116 catatattgtcttgtagttctttctcgacgaatattgtttatgtcttagacactcttcaggtgagcataaaagacaatatatgttatatattgacatcat 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37862534 catatattgtcttgtagttctttctcgacgaatattgtttatgtcttagacactcttcaggtgagcataaaagacaatatatgttatatattgacatcat 37862435  T
Q  216 aagt 219  Q
    ||||    
T  37862434 aagt 37862431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University