View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17117_low_53 (Length: 325)

Name: NF17117_low_53
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17117_low_53
NF17117_low_53
[»] chr4 (3 HSPs)
chr4 (99-314)||(1428191-1428410)
chr4 (142-178)||(1424991-1425027)
chr4 (1-35)||(1428091-1428125)


Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 99 - 314
Target Start/End: Original strand, 1428191 - 1428410
Alignment:
Q  99 tacaaatggtgaatctagggttcaaggaaaatcgagaacagtgtaaagagtgaaagagaaattagggttacat-accgagggaggaagtgaatgacactg 197  Q
    ||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  1428191 tacaaatggtgaatctagggttcaaggaaaaacgaaaacagtgtaaagagtgaaagagaaattagggttacattaccgagggaggaagtgaatgacactg 1428290  T
Q  198 caaatgcaaagggttttcgctgcgggaaggtttgtgaata---agtagggttttgtagttatgggcttatcacaaatagtgaggtgtaagcccgattatt 294  Q
    ||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1428291 caaatgcaaagggttttcgctgcgggaaggtttgtgaatataaagtagggttttgtagttatgggcttatcacaaatagtgaggtgtaagcccgattatt 1428390  T
Q  295 tagatccattgttttttctt 314  Q
    ||||||||||||||||||||    
T  1428391 tagatccattgttttttctt 1428410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 142 - 178
Target Start/End: Original strand, 1424991 - 1425027
Alignment:
Q  142 taaagagtgaaagagaaattagggttacataccgagg 178  Q
    |||||||||||||||||||||||||||||||||||||    
T  1424991 taaagagtgaaagagaaattagggttacataccgagg 1425027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 1428091 - 1428125
Alignment:
Q  1 ttcacttcttcacccatctctgttattcattaccc 35  Q
    ||||||||||||||||||||||| |||||||||||    
T  1428091 ttcacttcttcacccatctctgtgattcattaccc 1428125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University