View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17117_low_100 (Length: 210)

Name: NF17117_low_100
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17117_low_100
NF17117_low_100
[»] chr7 (1 HSPs)
chr7 (1-201)||(45641016-45641216)


Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 45641216 - 45641016
Alignment:
Q  1 cttgaataatcaccaccttacctctgctactcacatttacattcctataaaaagacgctgttgttattgttgttgatgatgacgaggatgaaagaagatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45641216 cttgaataatcaccaccttacctctgctactcacatttacattcctataaaaagacgctgttgttattgttgttgatgatgacgaggatgaaagaagatg 45641117  T
Q  101 ctttttgcttctaactctacgaatttgattcttggcttttgaaaattgattaagtaccaaccgttttccaaaatcaaattttgtacggtgcttcttcttc 200  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45641116 ttttttgcttctaactctacgaatttgattcttggcttttgaaaattgattaagtaccaaccgttttccaaaatcaaattttgtacggtgcttcttcttc 45641017  T
Q  201 t 201  Q
    |    
T  45641016 t 45641016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University