View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17112_low_25 (Length: 264)

Name: NF17112_low_25
Description: NF17112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17112_low_25
NF17112_low_25
[»] chr7 (2 HSPs)
chr7 (15-153)||(33489881-33490019)
chr7 (147-240)||(33489275-33489368)


Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 15 - 153
Target Start/End: Complemental strand, 33490019 - 33489881
Alignment:
Q  15 ctttatgtgaaaaaaccatgaattctcaattaaaattgattttgactataaaatttgcagcttttatctttataaatgttttttattgttcaactcgtat 114  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33490019 ctttatgtgaaaagaccatgaattctcaattaaaattgattttgactataaaatttgcagcttttatctttataaatgttttttattgttcaactcgtat 33489920  T
Q  115 aaatgatttttattgatcaactcattttatgtaaacata 153  Q
    |||||||||||||||||||||||||||||||||||||||    
T  33489919 aaatgatttttattgatcaactcattttatgtaaacata 33489881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 147 - 240
Target Start/End: Complemental strand, 33489368 - 33489275
Alignment:
Q  147 aaacataagttcgattcttaaactaatcagttcttgatcgaactttannnnnnncttaggcgaacttcatattatagggatagatcctttatga 240  Q
    |||| ||||||| ||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||    
T  33489368 aaacctaagttcaattcttaaactaatcagttcttgatcgaactttatatttttcttaggcgaacttcatattatagggatagatcctttatga 33489275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University