View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17111_high_4 (Length: 212)

Name: NF17111_high_4
Description: NF17111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17111_high_4
NF17111_high_4
[»] chr2 (1 HSPs)
chr2 (18-195)||(2930428-2930605)
[»] chr4 (1 HSPs)
chr4 (42-90)||(36117578-36117626)


Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 2930605 - 2930428
Alignment:
Q  18 ggttttaagaggaaggctttgggatttcagtatgaggaagagaatatgattgaaattgatatttctccgacgaagcgcagggagttttccggcgaggagg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2930605 ggttttaagaggaaggctttgggatttcagtatgaggaagagaatatgattgaaattgatatttctccgacgaagcgcagggagttttccggcgaggagg 2930506  T
Q  118 aggtgtttgccggtgagattagttgcaactaatgtgagatttaggaaggattgacatagtgtattactatcatgtgat 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2930505 aggtgtttgccggtgagattagttgcaactaatgtgagatttaggaaggattgacatagtgtattactatcatgtgat 2930428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 36117578 - 36117626
Alignment:
Q  42 tttcagtatgaggaagagaatatgattgaaattgatatttctccgacga 90  Q
    |||||||| || ||||||||| ||||||| |||||||||||||||||||    
T  36117578 tttcagtacgaagaagagaatttgattgagattgatatttctccgacga 36117626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University