View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1710_high_10 (Length: 285)

Name: NF1710_high_10
Description: NF1710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1710_high_10
NF1710_high_10
[»] chr2 (1 HSPs)
chr2 (24-244)||(14396411-14396626)


Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 24 - 244
Target Start/End: Complemental strand, 14396626 - 14396411
Alignment:
Q  24 atagtgcagactatatttcctgataattggccggatagaaagattcgaagatttagtacacttactttatattataccatacagtattggaatgtgtgtg 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||     ||||||||||||||||||    
T  14396626 atagtgcagactatatttcctgataattggccggatagaaagattcgaagatttaatacacttactttatactatac-----agtattggaatgtgtgtg 14396532  T
Q  124 ccgagccaagaagaaggagcccgaaacactacatgaaatactaacttctgatatcttccatagatgtttgcttgcatgtgctgctgctgatcaagtactc 223  Q
    ||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14396531 ccgagccgagaagaaggagcccgaaacaatacatgaaatactaacttctgatatcttccatagatgtttgcttgcatgtgctgctgctgatcaagtactc 14396432  T
Q  224 caaataactcgcactagcagc 244  Q
    |||||||||||||||||||||    
T  14396431 caaataactcgcactagcagc 14396411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University