View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17108_low_51 (Length: 220)

Name: NF17108_low_51
Description: NF17108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17108_low_51
NF17108_low_51
[»] chr6 (2 HSPs)
chr6 (14-133)||(32467436-32467557)
chr6 (176-205)||(32467391-32467420)


Alignment Details
Target: chr6 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 14 - 133
Target Start/End: Complemental strand, 32467557 - 32467436
Alignment:
Q  14 attatacttaaaatagatatatttatatagcatagaatatttatacatcttatatccaaatttcattg--ctctcaatatgagcatcttgggctagaata 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||  ||||||||||||||||||||||||||||||    
T  32467557 attatacttaaaatagatatatttatatagcatagaatatttatacatcttatatccaaattccattgctctctcaatatgagcatcttgggctagaata 32467458  T
Q  112 tgagctaatttattattacttc 133  Q
    ||||||||||||||||||||||    
T  32467457 tgagctaatttattattacttc 32467436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 176 - 205
Target Start/End: Complemental strand, 32467420 - 32467391
Alignment:
Q  176 tattactaagattgcttgttgttatttctt 205  Q
    ||||||||||||||||||||||||||||||    
T  32467420 tattactaagattgcttgttgttatttctt 32467391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University