View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17108_low_28 (Length: 289)

Name: NF17108_low_28
Description: NF17108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17108_low_28
NF17108_low_28
[»] chr3 (3 HSPs)
chr3 (28-122)||(304239-304333)
chr3 (187-274)||(304027-304126)
chr3 (131-173)||(304169-304211)


Alignment Details
Target: chr3 (Bit Score: 95; Significance: 2e-46; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 28 - 122
Target Start/End: Complemental strand, 304333 - 304239
Alignment:
Q  28 gtatgggttgatattctgttgtaataataatacaacattgatgtttcagtctaactctaatcatttatgaataaaatcatgatcatctgttttaa 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  304333 gtatgggttgatattctgttgtaataataatacaacattgatgtttcagtctaactctaatcatttatgaataaaatcatgatcatctgttttaa 304239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 187 - 274
Target Start/End: Complemental strand, 304126 - 304027
Alignment:
Q  187 atggaatagtctccaatggacaaaattaagattataattcaacatgtaatgc------------cattcaattatatcaaagaaaataacactactaaat 274  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||            ||||||||||||| ||||||||||||||||||||||    
T  304126 atggaatagtctccaatggaccaaattaagattataattcaacatgtaatgcatagtgttgtttcattcaattatataaaagaaaataacactactaaat 304027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 131 - 173
Target Start/End: Complemental strand, 304211 - 304169
Alignment:
Q  131 atcgaagattaacagatcactagagacagcgaaatacttccta 173  Q
    ||||||||||||||||||||||||||||| |||||||||||||    
T  304211 atcgaagattaacagatcactagagacagagaaatacttccta 304169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University