View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17108_high_37 (Length: 243)

Name: NF17108_high_37
Description: NF17108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17108_high_37
NF17108_high_37
[»] chr3 (1 HSPs)
chr3 (1-226)||(32046788-32047013)


Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 32046788 - 32047013
Alignment:
Q  1 tttccattaccagaatccatcttctcaatcatcttcgccaaagcataaaacgcactctttaccgaaccagaacccgtcactgacgaccccatctccggca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32046788 tttccattaccagaatccatcttctcaatcatcttcgccaaagcataaaacgcactctttaccgaaccagaacccgtcactgacgaccccatctccggca 32046887  T
Q  101 tagtttcttccaaacacaacacatgctcttgccccgcagctaccaaacacttcaacaaaaacaaattctccgaatccaactgaagcgtcgataaaaccct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32046888 tagtttcttccaaacacaacacatgctcttgccccgcagctaccaaacacttcaacaaaaacaaattctccgaatccaactgaagcgtcgataaaaccct 32046987  T
Q  201 agctagtccagcatttctggaagagg 226  Q
    ||||||||||||||||||||||||||    
T  32046988 agctagtccagcatttctggaagagg 32047013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University