View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17101_high_10 (Length: 224)

Name: NF17101_high_10
Description: NF17101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17101_high_10
NF17101_high_10
[»] chr1 (1 HSPs)
chr1 (132-224)||(17594752-17594847)


Alignment Details
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 132 - 224
Target Start/End: Complemental strand, 17594847 - 17594752
Alignment:
Q  132 ttaagtataatgtggctgttgattgttttcaaatgtcaataatttactatacccgtgtgccgacaaaagaaaa---ataaatgacaaacttgttat 224  Q
    ||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||   ||||||||||||||||||||    
T  17594847 ttaagtataatgtggttgttgattgttttcaaatgtcaacaatttactatacccgtgtgccgacaaaagaaaaaagataaatgacaaacttgttat 17594752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University