View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1709_high_16 (Length: 353)

Name: NF1709_high_16
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1709_high_16
NF1709_high_16
[»] chr8 (2 HSPs)
chr8 (131-210)||(41914757-41914836)
chr8 (6-71)||(41914891-41914956)


Alignment Details
Target: chr8 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 131 - 210
Target Start/End: Complemental strand, 41914836 - 41914757
Alignment:
Q  131 tacagggattggaaactaaggagctcgagggtctatatattaaggggaagagtgtgaaaaggaaggtatcaagaacacac 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41914836 tacagggattggaaactaaggagctcgagggtctatatattaaggggaagagtgtgaaaaggaaggtatcaagaacacac 41914757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 6 - 71
Target Start/End: Complemental strand, 41914956 - 41914891
Alignment:
Q  6 aaaaatgacaatgcagaagtgttttgagaagctgaactgaaacttcgtataatcccgctaattaag 71  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41914956 aaaaatgacaatgcagaagtgttttgagaagctgaactgaaacttcgtataatcccgctaattaag 41914891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University