View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17092_low_51 (Length: 231)

Name: NF17092_low_51
Description: NF17092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17092_low_51
NF17092_low_51
[»] chr6 (1 HSPs)
chr6 (84-218)||(3423650-3423785)


Alignment Details
Target: chr6 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 84 - 218
Target Start/End: Complemental strand, 3423785 - 3423650
Alignment:
Q  84 ccctatcgtcattttaagttaaccaaccgtcaaagattaaatctagctctaagaatactccaatgttttca--ctctataaaaagttttaccgaatataa 181  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||  |||||| ||| |||||||||| |||||    
T  3423785 ccctatcgtcattttaagttaaccaaccgtcaaagattgaatctagctctaagaatactccattgttttcactctctatgaaatgttttaccgattataa 3423686  T
Q  182 agttctatccaacatgagatattagtctttgtaattg 218  Q
    |||||||||| |||  |||||||| ||||||||||||    
T  3423685 agttctatcc-acacaagatattaatctttgtaattg 3423650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University