View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17092_high_43 (Length: 251)

Name: NF17092_high_43
Description: NF17092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17092_high_43
NF17092_high_43
[»] chr2 (1 HSPs)
chr2 (10-251)||(4675837-4676078)


Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 10 - 251
Target Start/End: Original strand, 4675837 - 4676078
Alignment:
Q  10 attattctctaacagttaaactaactaagactataacaattatatccttcaaaaaagacttttaacaattattttatttgagggcctttttccttgaaaa 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  4675837 attattctctaacagttaaactaactaagactataacaattatatccttcaaaaaagactattaacaattattttatttgagggcctttttccttgaaaa 4675936  T
Q  110 aatatatgttttattggagatctaaagcaagggtttggtccgcttcacccttgggtccgtgtaatacacaaaccatattannnnnnnaagggaaaaacca 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||        |||||||||||||    
T  4675937 aatatatgttttattggagatctaaagcaagggtttggtccgcttcatccttgggtccgtgtaatacacaaaccatattgtttttttaagggaaaaacca 4676036  T
Q  210 taatgattttattagttaaaatatggatcatatacgggaaaa 251  Q
    ||||||||||| |||||||||||||||| |||||||| ||||    
T  4676037 taatgattttagtagttaaaatatggataatatacggaaaaa 4676078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University