View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1709-Insertion-47 (Length: 66)

Name: NF1709-Insertion-47
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1709-Insertion-47
NF1709-Insertion-47
[»] scaffold2079 (1 HSPs)
scaffold2079 (8-66)||(1045-1103)
[»] chr7 (3 HSPs)
chr7 (8-66)||(6325785-6325843)
chr7 (8-66)||(6333262-6333320)
chr7 (35-66)||(6242854-6242885)


Alignment Details
Target: scaffold2079 (Bit Score: 55; Significance: 2e-23; HSPs: 1)
Name: scaffold2079
Description:

Target: scaffold2079; HSP #1
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 8 - 66
Target Start/End: Original strand, 1045 - 1103
Alignment:
Q  8 gttgtttcaattttagcattgatggttatttcgccgactattgcttggatttatttggg 66  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  1045 gttgtttcaattttagcattgatggttatttcgccgacaattgcttggatttatttggg 1103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 43; Significance: 3e-16; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 8 - 66
Target Start/End: Complemental strand, 6325843 - 6325785
Alignment:
Q  8 gttgtttcaattttagcattgatggttatttcgccgactattgcttggatttatttggg 66  Q
    ||||||||||||||||| || ||||||||||||||||| ||||| ||||||||||||||    
T  6325843 gttgtttcaattttagctttaatggttatttcgccgacaattgcatggatttatttggg 6325785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 66
Target Start/End: Complemental strand, 6333320 - 6333262
Alignment:
Q  8 gttgtttcaattttagcattgatggttatttcgccgactattgcttggatttatttggg 66  Q
    ||||||||| ||||||| |||||| | ||||| || || ||||||||||||||||||||    
T  6333320 gttgtttcagttttagctttgatgataatttctcctacaattgcttggatttatttggg 6333262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 66
Target Start/End: Original strand, 6242854 - 6242885
Alignment:
Q  35 atttcgccgactattgcttggatttatttggg 66  Q
    ||||||||||| ||||||||||||||||||||    
T  6242854 atttcgccgacaattgcttggatttatttggg 6242885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University