View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17087_high_62 (Length: 241)

Name: NF17087_high_62
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17087_high_62
NF17087_high_62
[»] chr4 (2 HSPs)
chr4 (140-195)||(11856833-11856888)
chr4 (26-78)||(11856887-11856939)


Alignment Details
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 140 - 195
Target Start/End: Complemental strand, 11856888 - 11856833
Alignment:
Q  140 aaaaatttaacaccctatcactaagaaattttcagtttatgaaaacagttctctac 195  Q
    |||| |||||||||||||| |||||||||||||||||||||||||||| |||||||    
T  11856888 aaaattttaacaccctatctctaagaaattttcagtttatgaaaacagctctctac 11856833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 78
Target Start/End: Complemental strand, 11856939 - 11856887
Alignment:
Q  26 ctaattgaatattattggatgctttggatctcctttagtgaaaacagcacgaa 78  Q
    ||||||||||||||||||||| |||||||||||| | |||||||  |||||||    
T  11856939 ctaattgaatattattggatgttttggatctcctatggtgaaaattgcacgaa 11856887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University