View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17087_high_45 (Length: 285)

Name: NF17087_high_45
Description: NF17087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17087_high_45
NF17087_high_45
[»] chr7 (1 HSPs)
chr7 (20-278)||(43672477-43672735)


Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 20 - 278
Target Start/End: Original strand, 43672477 - 43672735
Alignment:
Q  20 atagtaagaaaaggtggtggtttagggaggaacacggtggttgaaaaggctgaggaaaacggtgctgtagcggttctggtttataatgatgagaatgaca 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  43672477 atagtaagaaaaggtggtggtttagggaggaacacggtggttgaaaaggctgaggaaaacggtgctgtagcggttctagtttataatgatgagaatgaca 43672576  T
Q  120 cgtggcgtgatgggtttgagagaggtcacgtgatgaaaggtgtaggggacccacttagtcctggttggggtagtgttgaaggtagtgagaagttgagttt 219  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43672577 cgtggcgtaatgggtttgagagaggtcacgtgatgaaaggtgtaggggacccacttagtcctggttggggtagtgttgaaggtagtgagaagttgagttt 43672676  T
Q  220 ggatgataatgaagttttgaaaaggttccctaaaattccatctatgccactctctgctc 278  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43672677 ggatgataatgaagttttgaaaaggttccctaaaattccatctatgccactctctgctc 43672735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University