View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17083_low_58 (Length: 204)

Name: NF17083_low_58
Description: NF17083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17083_low_58
NF17083_low_58
[»] chr6 (1 HSPs)
chr6 (17-181)||(34879569-34879733)


Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 181
Target Start/End: Original strand, 34879569 - 34879733
Alignment:
Q  17 gcatagggtgatgcctgacaagaatggaagtagactatctattgcaagtttctataatccagttggtgaagctattatttctccagctcctaaactcttg 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34879569 gcatagggtgatgcctgacaagaatggaagtagactatctattgcaagtttctataatccagttggtgaagctattatttctccagctcctaaactcttg 34879668  T
Q  117 tatccaagtaattactgctatggtgactatttggagctttatggaaaaactaagtttggtgataa 181  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34879669 tatccaagtaattactgctatggtgactatttggagctttatggaaaaactaagtttggtgataa 34879733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University