View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17083_low_44 (Length: 250)

Name: NF17083_low_44
Description: NF17083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17083_low_44
NF17083_low_44
[»] chr2 (2 HSPs)
chr2 (1-185)||(36021533-36021716)
chr2 (197-236)||(36021498-36021537)


Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 36021716 - 36021533
Alignment:
Q  1 ctttttatcctaccagccaaatcataaattattttttaaaattagatatgataaaagtcaaagtcttttaatgatcgaaagaaatataattggttgacag 100  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |    
T  36021716 ctttttatcctagcagccaaatcataaattattttttaaaattagatatgataagagtcaaagtcttttaatgatcgaaag-aatataattggttgaccg 36021618  T
Q  101 tataattgttttacaatattttgaacgtaacaatttannnnnnnatgcaggaaataactaatataatatcaggatcatatgagtc 185  Q
    | ||||||||||||||||||||||||||||| |||||       ||||||||||||||||||||||| |||||||||||||||||    
T  36021617 tgtaattgttttacaatattttgaacgtaacgatttatttttttatgcaggaaataactaatataatctcaggatcatatgagtc 36021533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 36021537 - 36021498
Alignment:
Q  197 gagtcttgtataagaaaacaaataaaccgcaaaaaatagt 236  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  36021537 gagtcttgtataagaaaacaaataaaccgcaaaaaatagt 36021498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University