View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17082_low_76 (Length: 217)

Name: NF17082_low_76
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17082_low_76
NF17082_low_76
[»] chr8 (1 HSPs)
chr8 (31-200)||(14000672-14000841)


Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 31 - 200
Target Start/End: Complemental strand, 14000841 - 14000672
Alignment:
Q  31 aaaaacctgaatttgatttggacatcttcggaccaatttttcacccagccacctagttcggtttcaggttcttattttgccacccaatcaaactgaaccg 130  Q
    |||||||| |||||| ||||||| |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||| ||||||    
T  14000841 aaaaacctaaatttggtttggacgtcttcggaccaatttttcacccagccacgtggttcggtttcaggttcttattttgccacccaaccaaaccgaaccg 14000742  T
Q  131 tggattcacttaattaaatgtattgaattagtaactcatgaaacactcgactgaactcaaacactcttca 200  Q
     ||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  14000741 cggattcacttaattagatgtattgaattagtaactcatcaaacactcgactgaactcaaacactcttca 14000672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University